Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 9184997
End position: 9185059
Length: 63

DNA sequence
>NC_022785, from 9184997 to 9185059 (63 bp); Streptomyces rapamycinicus NRRL 5491 CGGAGGTCTCGTCGATGGCGGTGGAGGTCTCGTCCACGGAGGTGGAGGTCTCGTCCATGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9184957-9185874	Sequence	M271_37565 - gas vesicle protein (Protein is coded in complementary strand; from 9185874 to 9184957)