Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 9142267
End position: 9142290
Length: 24

DNA sequence
>NC_022785, from 9142267 to 9142290 (24 bp); Streptomyces rapamycinicus NRRL 5491 TCCCGTTGCCGTTGCCGTTCCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9141381-9142769	Sequence	M271_37370 - hypothetical protein (Protein is coded in complementary strand; from 9142769 to 9141381)