Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 9100189
End position: 9100212
Length: 24

DNA sequence
>NC_022785, from 9100189 to 9100212 (24 bp); Streptomyces rapamycinicus NRRL 5491 AGCGCCCGCGCCCGCGCCAGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9098737-9100272	Sequence	M271_37175 - peptidase U62 modulator of DNA gyrase (Protein is coded in complementary strand; from 9100272 to 9098737)