Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 9048388
End position: 9048447
Length: 60

DNA sequence
>NC_022785, from 9048388 to 9048447 (60 bp); Streptomyces rapamycinicus NRRL 5491 CGTCGGCCGGTAGGGCGTCAGCGGGTAAGGCGTCGGCCGGTAGTGCGTCGGCCGGTAAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 9047664-9048389	Sequence	M271_36955 - hypothetical protein (Protein is coded in complementary strand; from 9048389 to 9047664)