Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8948149
End position: 8948175
Length: 27

DNA sequence
>NC_022785, from 8948149 to 8948175 (27 bp); Streptomyces rapamycinicus NRRL 5491 CGCTCCCGCCGCTCCAGCCGCTCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8947558-8948211	Sequence	M271_36525 - methylated-DNA--protein-cysteine methyltransferase (Protein is coded in complementary strand; from 8948211 to 8947558)