Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8875106
End position: 8875150
Length: 45

DNA sequence
>NC_022785, from 8875106 to 8875150 (45 bp); Streptomyces rapamycinicus NRRL 5491 CGACGACCACCGCCGCGGCCACCACCGCCGCGATGACGATCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 8874493-8875131	Sequence	M271_36195 - hypothetical protein (Protein is coded in complementary strand; from 8875131 to 8874493)