Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8797450
End position: 8797485
Length: 36

DNA sequence
>NC_022785, from 8797450 to 8797485 (36 bp); Streptomyces rapamycinicus NRRL 5491 TTCTCGCCGTTCTCACCGCTCTCGCCGTTCTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8797345-8798199	Sequence	M271_35865 - ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 8798199 to 8797345)