Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8785669
End position: 8785695
Length: 27

DNA sequence
>NC_022785, from 8785669 to 8785695 (27 bp); Streptomyces rapamycinicus NRRL 5491 GGCGCCGGGGGCGCCGGGGGCACCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8785637-8786959	Sequence	M271_35820 - glycine oxidase (Protein is coded in complementary strand; from 8786959 to 8785637)