Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8784505
End position: 8784561
Length: 57

DNA sequence
>NC_022785, from 8784505 to 8784561 (57 bp); Streptomyces rapamycinicus NRRL 5491 CTGGACCCAGCCGAAGGCCCGTGGCCCAGCCGAAGGCCCAGGGCCTAGCCGAAGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 8784550-8785431	Sequence	M271_35810 thiG thiazole synthase (Protein is coded in complementary strand; from 8785431 to 8784550)