Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8721594
End position: 8721617
Length: 24

DNA sequence
>NC_022785, from 8721594 to 8721617 (24 bp); Streptomyces rapamycinicus NRRL 5491 GTTCTTCTTCTTGTCCTTGTCCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8720536-8722068	Sequence	M271_35500 - aminopeptidase A (Protein is coded in complementary strand; from 8722068 to 8720536)