Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8687887
End position: 8687913
Length: 27

DNA sequence
>NC_022785, from 8687887 to 8687913 (27 bp); Streptomyces rapamycinicus NRRL 5491 GGCTTGGCGGGCTTGGCGGGCTTGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8686462-8687949	Sequence	M271_35370 - hypothetical protein (Protein is coded in complementary strand; from 8687949 to 8686462)