Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8657306
End position: 8657350
Length: 45

DNA sequence
>NC_022785, from 8657306 to 8657350 (45 bp); Streptomyces rapamycinicus NRRL 5491 TGCCGCCGACCGGTCAGCCGCCGACCGGTCAGCCGCCCGCCGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8656364-8657395	Sequence	M271_35260 - LacI family transcriptional regulator
ORF... 8657350-8658813	Sequence	M271_35265 - hypothetical protein (Protein is coded in complementary strand; from 8658813 to 8657350)