Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8651533
End position: 8651559
Length: 27

DNA sequence
>NC_022785, from 8651533 to 8651559 (27 bp); Streptomyces rapamycinicus NRRL 5491 GCCGTCCTGGCCGTCCTGGCCCTCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8651135-8652805	Sequence	M271_35240 - alpha-glucosidase (Protein is coded in complementary strand; from 8652805 to 8651135)