Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8633082
End position: 8633123
Length: 42

DNA sequence
>NC_022785, from 8633082 to 8633123 (42 bp); Streptomyces rapamycinicus NRRL 5491 GTGGCCGTGGCTTTGGCCCTGGCCGTCGCCGTGGCCTTGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8632203-8633885	Sequence	M271_35155 - copper oxidase (Protein is coded in complementary strand; from 8633885 to 8632203)