Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8586481
End position: 8586505
Length: 25

DNA sequence
>NC_022785, from 8586481 to 8586505 (25 bp); Streptomyces rapamycinicus NRRL 5491 CGGCCCGGACCGGCTTGGCCCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8586021-8586926	Sequence	M271_34965 - hypothetical protein (Protein is coded in complementary strand; from 8586926 to 8586021)