Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8566424
End position: 8566459
Length: 36

DNA sequence
>NC_022785, from 8566424 to 8566459 (36 bp); Streptomyces rapamycinicus NRRL 5491 CCCCGCCGGTGTCCCCGCCGGTGTCCCCGCCGGTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8564185-8566698	Sequence	M271_34875 - magnesium or manganese-dependent protein phosphatase (Protein is coded in complementary strand; from 8566698 to 8564185)