Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8561305
End position: 8561328
Length: 24

DNA sequence
>NC_022785, from 8561305 to 8561328 (24 bp); Streptomyces rapamycinicus NRRL 5491 GCCACCGCCGCCGCCCCCGGCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8560610-8561581	Sequence	M271_34860 - cytochrome C biogenesis protein (Protein is coded in complementary strand; from 8561581 to 8560610)