Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8366426
End position: 8366461
Length: 36

DNA sequence
>NC_022785, from 8366426 to 8366461 (36 bp); Streptomyces rapamycinicus NRRL 5491 GAACAGGGCGAGGAACAGGGCGAGGAACAGGGCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8365812-8366516	Sequence	M271_34030 - hypothetical protein (Protein is coded in complementary strand; from 8366516 to 8365812)