Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8337215
End position: 8337250
Length: 36

DNA sequence
>NC_022785, from 8337215 to 8337250 (36 bp); Streptomyces rapamycinicus NRRL 5491 TGCCTTCGCCGCTGCCGTCCCCGCCGCCTTCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8337007-8337270	Sequence	M271_33895 - hypothetical protein (Protein is coded in complementary strand; from 8337270 to 8337007)