Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8332231
End position: 8332257
Length: 27

DNA sequence
>NC_022785, from 8332231 to 8332257 (27 bp); Streptomyces rapamycinicus NRRL 5491 GACGGACCCGACCGACCCGACCGACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 8331514-8332233	Sequence	M271_33865 - hypothetical protein
ORF. 8332227-8332748	Sequence	M271_33870 - hypothetical protein