Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8328262
End position: 8328288
Length: 27

DNA sequence
>NC_022785, from 8328262 to 8328288 (27 bp); Streptomyces rapamycinicus NRRL 5491 CCGGCGTCACCGGCATCACCGGCATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8327509-8328561	Sequence	M271_33850 - hypothetical protein (Protein is coded in complementary strand; from 8328561 to 8327509)