Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8322626
End position: 8322661
Length: 36

DNA sequence
>NC_022785, from 8322626 to 8322661 (36 bp); Streptomyces rapamycinicus NRRL 5491 CGTGGTGACCGCCTTGGCGACCGCCGTGGTGACCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8321983-8323785	Sequence	M271_33830 - alkaline phosphatase (Protein is coded in complementary strand; from 8323785 to 8321983)