Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8312854
End position: 8312898
Length: 45

DNA sequence
>NC_022785, from 8312854 to 8312898 (45 bp); Streptomyces rapamycinicus NRRL 5491 GACGGAGGTGGCGGAGGTGACGGACGTGGCGGAGGTGACGGACGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8312798-8313175	Sequence	M271_33785 - hypothetical protein (Protein is coded in complementary strand; from 8313175 to 8312798)