Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8299847
End position: 8299870
Length: 24

DNA sequence
>NC_022785, from 8299847 to 8299870 (24 bp); Streptomyces rapamycinicus NRRL 5491 CGGTCACCCGGTCACCCGGTCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 8299867-8301006	Sequence	M271_33700 - FAD-dependent oxidoreductase (Protein is coded in complementary strand; from 8301006 to 8299867)