Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8259783
End position: 8259806
Length: 24

DNA sequence
>NC_022785, from 8259783 to 8259806 (24 bp); Streptomyces rapamycinicus NRRL 5491 CGGCTGAGGCTGCGGCTGCGGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8259631-8260752	Sequence	M271_33480 - hypothetical protein (Protein is coded in complementary strand; from 8260752 to 8259631)