Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8245631
End position: 8245666
Length: 36

DNA sequence
>NC_022785, from 8245631 to 8245666 (36 bp); Streptomyces rapamycinicus NRRL 5491 CGCGGTGGAGGACGCGGTGGAGGACGCGGTGGAGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8244330-8245727	Sequence	M271_33415 - histidine kinase (Protein is coded in complementary strand; from 8245727 to 8244330)