Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 823300
End position: 823326
Length: 27

DNA sequence
>NC_022785, from 823300 to 823326 (27 bp); Streptomyces rapamycinicus NRRL 5491 CCGGACCTGCCGGACCTGCCGGACCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 822877-823875	Sequence	M271_03430 - hypothetical protein (Protein is coded in complementary strand; from 823875 to 822877)