Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 822508
End position: 822534
Length: 27

DNA sequence
>NC_022785, from 822508 to 822534 (27 bp); Streptomyces rapamycinicus NRRL 5491 CGATCGCGACGACCGCGACGACCGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 821841-822638	Sequence	M271_03425 - hypothetical protein (Protein is coded in complementary strand; from 822638 to 821841)