Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8204188
End position: 8204223
Length: 36

DNA sequence
>NC_022785, from 8204188 to 8204223 (36 bp); Streptomyces rapamycinicus NRRL 5491 CGGCGGGCTGGGCGGCGGGCTGGTCGGTGGGCTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8203101-8204276	Sequence	M271_33235 - hypothetical protein (Protein is coded in complementary strand; from 8204276 to 8203101)