Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8156513
End position: 8156539
Length: 27

DNA sequence
>NC_022785, from 8156513 to 8156539 (27 bp); Streptomyces rapamycinicus NRRL 5491 TCGGCGGATTCGGCGGATTCGGCGGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8155442-8156977	Sequence	M271_33010 - hypothetical protein (Protein is coded in complementary strand; from 8156977 to 8155442)