Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8152946
End position: 8152972
Length: 27

DNA sequence
>NC_022785, from 8152946 to 8152972 (27 bp); Streptomyces rapamycinicus NRRL 5491 GTGGCCCGGGTGGCCCGGGTGGCCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8152281-8153021	Sequence	M271_32995 - ATP/GTP-binding protein (Protein is coded in complementary strand; from 8153021 to 8152281)