Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8151022
End position: 8151045
Length: 24

DNA sequence
>NC_022785, from 8151022 to 8151045 (24 bp); Streptomyces rapamycinicus NRRL 5491 CCCGATCCCGATCCCGATCCCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8150962-8152284	Sequence	M271_32990 - cytochrome P450 (Protein is coded in complementary strand; from 8152284 to 8150962)