Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 8148677
End position: 8148730
Length: 54

DNA sequence
>NC_022785, from 8148677 to 8148730 (54 bp); Streptomyces rapamycinicus NRRL 5491 ACGCCGCTCACCGCGCGCCCGCCGCTCACCGCGCGCCCGCCGCTCACCGCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8147711-8149540	Sequence	M271_32980 - hypothetical protein (Protein is coded in complementary strand; from 8149540 to 8147711)