Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 7992602
End position: 7992637
Length: 36

DNA sequence
>NC_022785, from 7992602 to 7992637 (36 bp); Streptomyces rapamycinicus NRRL 5491 CGTCCTGAGCCCCGCCCTGAGCCCCGTCCTCAGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7992520-7993764	Sequence	M271_32285 - peptidase M48 (Protein is coded in complementary strand; from 7993764 to 7992520)