Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 7985386
End position: 7985409
Length: 24

DNA sequence
>NC_022785, from 7985386 to 7985409 (24 bp); Streptomyces rapamycinicus NRRL 5491 GGCGGCGGTGGCCGCGGCGACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7984853-7986940	Sequence	M271_32255 - membrane protein (Protein is coded in complementary strand; from 7986940 to 7984853)