Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 797697
End position: 797720
Length: 24

DNA sequence
>NC_022785, from 797697 to 797720 (24 bp); Streptomyces rapamycinicus NRRL 5491 GCGGCGGCGACGGCGGCGGCGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 797304-798479	Sequence	M271_03275 - hypothetical protein (Protein is coded in complementary strand; from 798479 to 797304)