Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 7933756
End position: 7933809
Length: 54

DNA sequence
>NC_022785, from 7933756 to 7933809 (54 bp); Streptomyces rapamycinicus NRRL 5491 TCGGCGGCGGGGGCCGCGTCGGCGGTGGCGGCCGCGTCGGCCGGGGGTGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7932259-7933992	Sequence	M271_32050 - alpha-galactosidase (Protein is coded in complementary strand; from 7933992 to 7932259)