Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 7930081
End position: 7930104
Length: 24

DNA sequence
>NC_022785, from 7930081 to 7930104 (24 bp); Streptomyces rapamycinicus NRRL 5491 GCCAGGGTCAGGGCCAGCGGCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7928680-7930884	Sequence	M271_32035 - ATP/GTP-binding protein (Protein is coded in complementary strand; from 7930884 to 7928680)