Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 7885784
End position: 7885807
Length: 24

DNA sequence
>NC_022785, from 7885784 to 7885807 (24 bp); Streptomyces rapamycinicus NRRL 5491 GTCCGGCTCCGGCTCCGGCTCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7884657-7885928	Sequence	M271_31885 - magnesium or manganese-dependent protein phosphatase (Protein is coded in complementary strand; from 7885928 to 7884657)