Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 77531
End position: 77575
Length: 45

DNA sequence
>NC_022785, from 77531 to 77575 (45 bp); Streptomyces rapamycinicus NRRL 5491 CACTCCGCCGTCACCGACTCCGGCGTCACCAGCTCCCCCGTCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 76431-96695	Sequence	M271_00310 - hypothetical protein (Protein is coded in complementary strand; from 96695 to 76431)