Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 7593558
End position: 7593599
Length: 42

DNA sequence
>NC_022785, from 7593558 to 7593599 (42 bp); Streptomyces rapamycinicus NRRL 5491 AACCGGGCCGTCAGGACCAGGCCGTCAGAACTGGGCCGTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 7593583-7594392	Sequence	M271_31175 - phosphatase (Protein is coded in complementary strand; from 7594392 to 7593583)