Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 758961
End position: 758984
Length: 24

DNA sequence
>NC_022785, from 758961 to 758984 (24 bp); Streptomyces rapamycinicus NRRL 5491 GCGGCGGAGGCGGCGGCGTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 756678-759662	Sequence	M271_03100 - hypothetical protein (Protein is coded in complementary strand; from 759662 to 756678)