Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 7588520
End position: 7588543
Length: 24

DNA sequence
>NC_022785, from 7588520 to 7588543 (24 bp); Streptomyces rapamycinicus NRRL 5491 CCGGCGTCGGCGCAGGCGCGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7586660-7588852	Sequence	M271_31150 - biotin carboxyl carrier protein (Protein is coded in complementary strand; from 7588852 to 7586660)