Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 7581554
End position: 7581619
Length: 66

DNA sequence
>NC_022785, from 7581554 to 7581619 (66 bp); Streptomyces rapamycinicus NRRL 5491 GCCGTCCCTCAGGCGCGGGGAAGCCGGCCCTCGGTCGCCGGGAAGCCGTCCCTCAGGCGTCGGAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 7581607-7582518	Sequence	M271_31130 - hypothetical protein (Protein is coded in complementary strand; from 7582518 to 7581607)