Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 7575696
End position: 7575731
Length: 36

DNA sequence
>NC_022785, from 7575696 to 7575731 (36 bp); Streptomyces rapamycinicus NRRL 5491 CCGCTCCAGCCGCTCCAGCCGCTCCAGCCGCTCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7575445-7576785	Sequence	M271_31105 - AraC family transcriptional regulator (Protein is coded in complementary strand; from 7576785 to 7575445)