Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 7536737
End position: 7536763
Length: 27

DNA sequence
>NC_022785, from 7536737 to 7536763 (27 bp); Streptomyces rapamycinicus NRRL 5491 CGCCGCCTCCACCGCCTCCGCCGCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7536192-7537469	Sequence	M271_30890 - hypothetical protein (Protein is coded in complementary strand; from 7537469 to 7536192)