Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 7534814
End position: 7534840
Length: 27

DNA sequence
>NC_022785, from 7534814 to 7534840 (27 bp); Streptomyces rapamycinicus NRRL 5491 CGGCTCCGTCGGCCCCGTCGGCCCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7534486-7536201	Sequence	M271_30885 - membrane protein (Protein is coded in complementary strand; from 7536201 to 7534486)