Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 7531836
End position: 7531880
Length: 45

DNA sequence
>NC_022785, from 7531836 to 7531880 (45 bp); Streptomyces rapamycinicus NRRL 5491 CGGACTCCCGGGCTCCGGACTCCCGGGCCCGGGGCTCCCGGGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7531673-7532344	Sequence	M271_30870 - hypothetical protein (Protein is coded in complementary strand; from 7532344 to 7531673)