Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 7525383
End position: 7525409
Length: 27

DNA sequence
>NC_022785, from 7525383 to 7525409 (27 bp); Streptomyces rapamycinicus NRRL 5491 CCGGCGACCCCGGCGACCCCGGCGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7525236-7525481	Sequence	M271_30835 - hypothetical protein (Protein is coded in complementary strand; from 7525481 to 7525236)