Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 7521447
End position: 7521470
Length: 24

DNA sequence
>NC_022785, from 7521447 to 7521470 (24 bp); Streptomyces rapamycinicus NRRL 5491 CCCCGTCACGCCGTCACGCCGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 7521461-7522696	Sequence	M271_30825 - histidine kinase (Protein is coded in complementary strand; from 7522696 to 7521461)